Primer Sequences These are the sequences of the primers that we have aliquots of here in the core for our users to make use of.    M13F(-21)   GTAAAACGACGGCCAGT 3' M13R CAGGAAACAGCTATGAC 3' T7prom TAATACGACTCACTATAGG 3' T7term GCTAGTTATTGCTCAGCGG 3' T3prom ATTAACCCTCACTAAAGGG3' SP6 GATTTAGGTGACACTATAG 3' CMV-F CGCAAATGGGCGGTAGGCGTG 3' CMV-R AGTAGGAAAGTCCCGTAAGG EGFP-C CATGGTCCTGCTGGAGTTCGTG EGFP-N        CGTCGCCGTCCAGCTCGACCAG   All users are welcome to come get an aliquot of 50uL of 2uM primer dilutions for use on samples here through our core.  Please do NOT re-freeze the aliquots.  They will store fine in the fridge.  Repeated freeze/thaw cycles of unconcentrated primers can be problematic is Sanger sequencing.