# Primer Sequences

These are the sequences of the primers that we have aliquots of here in the core for our users to make use of.

M13F(-21)<span style="mso-tab-count: 1;"> </span> GTAAAACGACGGCCAGT 3'

M13R<span style="mso-tab-count: 1;"> </span>CAGGAAACAGCTATGAC 3'

T7prom<span style="mso-tab-count: 1;"> </span>TAATACGACTCACTATAGG 3'

T7term<span style="mso-tab-count: 1;"> </span>GCTAGTTATTGCTCAGCGG 3'

T3prom<span style="mso-tab-count: 1;"> </span>ATTAACCCTCACTAAAGGG3'

SP6<span style="mso-tab-count: 1;"> </span>GATTTAGGTGACACTATAG 3'

CMV-F<span style="mso-tab-count: 1;"> </span>CGCAAATGGGCGGTAGGCGTG 3'

CMV-R<span style="mso-tab-count: 1;"> </span>AGTAGGAAAGTCCCGTAAGG

EGFP-C<span style="mso-tab-count: 1;"> </span>CATGGTCCTGCTGGAGTTCGTG

EGFP-N CGTCGCCGTCCAGCTCGACCAG

All users are welcome to come get an aliquot of 50uL of 2uM primer dilutions for use on samples here through our core. Please do NOT re-freeze the aliquots. They will store fine in the fridge. Repeated freeze/thaw cycles of unconcentrated primers can be problematic is Sanger sequencing.